Regulon of LacI in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_02824
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Lactose utilization
Effector:	Allolactose
Regulog:	LacI - Enterobacteriales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Allolactose
By pathway - Lactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 7 Sequence: AATTGTGAGCGAATAACAAAC Locus tag: CKO_02825 Name: lacZ Funciton: Beta-galactosidase (EC 3.2.1.23)
	CKO_02825	lacZ	Beta-galactosidase (EC 3.2.1.23)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD