Regulon of LacI in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b0345
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Lactose utilization
Effector:	Allolactose
Regulog:	LacI - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Allolactose
By pathway - Lactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 7.4 Sequence: AATTGTGAGCGGATAACAATT Locus tag: b0344 Name: lacZ Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: b0343 Name: lacY Funciton: Lactose permease, MFS family Locus tag: b0342 Name: lacA Funciton: Galactoside O-acetyltransferase (EC 2.3.1.18)
	b0344	lacZ	Beta-galactosidase (EC 3.2.1.23)
	b0343	lacY	Lactose permease, MFS family
	b0342	lacA	Galactoside O-acetyltransferase (EC 2.3.1.18)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD