Regulog IclR - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	Glyoxylate bypass
Effector:	Pyruvate; Glyoxylate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - IclR
By effector - Pyruvate
By effector - Glyoxylate
By pathway - Glyoxylate bypass

Statistics of regulated genes
Genome	Genes	Operons
Escherichia coli str. K-12 substr. MG1655	3	1
Salmonella typhimurium LT2	3	1
Citrobacter koseri ATCC BAA-895	3	1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	3	1
Enterobacter sp. 638	3	1
Erwinia amylovora ATCC 49946
Yersinia pestis KIM	3	1
Serratia proteamaculans 568	3	1
Erwinia carotovora subsp. atroseptica SCRI1043	3	1
Edwardsiella tarda EIB202
Proteus mirabilis HI4320	3	1
Photorhabdus luminescens subsp. laumondii TTO1	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
aceB	* Escherichia coli str. K-12 substr. MG1655 Site: position = -125 score = 8.32743 sequence = AAAATGGAAATTGTTTTTGATTTT Gene: b4014: malate synthase A	* Salmonella typhimurium LT2 Site: position = -125 score = 8.32743 sequence = AAAATGGAAATTGTTTTTGATTTT Gene: STM4183: malate synthase A	* Citrobacter koseri ATCC BAA-895 Site: position = -125 score = 8.32743 sequence = AAAATGGAAATTGTTTTTGATTTT Gene: CKO_03906: malate synthase A	* Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -117 score = 8.32743 sequence = AAAATGGAAATTGTTTTTGATTTT Gene: KPN_04395: malate synthase A	* Enterobacter sp. 638 Site: position = -127 score = 8.32743 sequence = AAAATGGAAATTGTTTTTGATTTT Gene: Ent638_0218: malate synthase A	Erwinia amylovora ATCC 49946	* Yersinia pestis KIM Site: position = -147 score = 8.17439 sequence = AAAATGGAAATCGTTTTTGATTTT Gene: y0015: malate synthase A	* Serratia proteamaculans 568 Site: position = -172 score = 8.09146 sequence = AAAATGGAAATGGTTTTTGATTTT Gene: Spro_4503: malate synthase A	* Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -132 score = 8.32743 sequence = AAAATGGAAATTGTTTTTGATTTT Gene: ECA3991: malate synthase A	Edwardsiella tarda EIB202	* Proteus mirabilis HI4320 Site: position = -80 score = 7.61703 sequence = AAAATGGAATTCATTTTTGATTTT Gene: PMI2764: malate synthase A	* Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -77 score = 7.89571 sequence = AAAATGGAAATCGTTTTTGATTTA Gene: plu4396: malate synthase A	malate synthase A
aceA	Escherichia coli str. K-12 substr. MG1655 Gene: b4015: isocitrate lyase	Salmonella typhimurium LT2 Gene: STM4184: isocitrate lyase	Citrobacter koseri ATCC BAA-895 Gene: CKO_03905: isocitrate lyase	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_04396: isocitrate lyase	Enterobacter sp. 638 Gene: Ent638_0219: isocitrate lyase	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y0016: isocitrate lyase	Serratia proteamaculans 568 Gene: Spro_4502: isocitrate lyase	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3990: isocitrate lyase	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI2763: isocitrate lyase	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu4395: isocitrate lyase	isocitrate lyase
aceK	Escherichia coli str. K-12 substr. MG1655 Gene: b4016: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	Salmonella typhimurium LT2 Gene: STM4185: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	Citrobacter koseri ATCC BAA-895 Gene: CKO_03904: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Gene: KPN_04397: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	Enterobacter sp. 638 Gene: Ent638_0220: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	Erwinia amylovora ATCC 49946	Yersinia pestis KIM Gene: y0018: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	Serratia proteamaculans 568 Gene: Spro_4501: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	Erwinia carotovora subsp. atroseptica SCRI1043 Gene: ECA3989: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	Edwardsiella tarda EIB202	Proteus mirabilis HI4320 Gene: PMI2762: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	Photorhabdus luminescens subsp. laumondii TTO1 Gene: plu4394: bifunctional isocitrate dehydrogenase kinase/phosphatase protein	bifunctional isocitrate dehydrogenase kinase/phosphatase protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IclR - Enterobacteriales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --