Regulon of IclR in Proteus mirabilis HI4320

Properties
Regulator type:	Transcription factor
TF locus tag:	PMI2759
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	Glyoxylate bypass
Effector:	Pyruvate; Glyoxylate
Regulog:	IclR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - IclR
By effector - Pyruvate
By effector - Glyoxylate
By pathway - Glyoxylate bypass

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 7.6 Sequence: AAAATGGAATTCATTTTTGATTTT Locus tag: PMI2764 Name: aceB Funciton: malate synthase A Locus tag: PMI2763 Name: aceA Funciton: isocitrate lyase Locus tag: PMI2762 Name: aceK Funciton: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
	PMI2764	aceB	malate synthase A
	PMI2763	aceA	isocitrate lyase
	PMI2762	aceK	bifunctional isocitrate dehydrogenase kinase/phosphatase protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD