Regulon of IclR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_0221
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	Glyoxylate bypass
Effector:	Pyruvate; Glyoxylate
Regulog:	IclR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - IclR
By effector - Pyruvate
By effector - Glyoxylate
By pathway - Glyoxylate bypass

Regulated operons
	Locus Tag	Name	Function
Position: -127 Score: 8.3 Sequence: AAAATGGAAATTGTTTTTGATTTT Locus tag: Ent638_0218 Name: aceB Funciton: malate synthase A Locus tag: Ent638_0219 Name: aceA Funciton: isocitrate lyase Locus tag: Ent638_0220 Name: aceK Funciton: bifunctional isocitrate dehydrogenase kinase/phosphatase protein
	Ent638_0218	aceB	malate synthase A
	Ent638_0219	aceA	isocitrate lyase
	Ent638_0220	aceK	bifunctional isocitrate dehydrogenase kinase/phosphatase protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD