Profile of regulator IolR2 in Corynebacteriaceae
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Inositol utilization |
| Effector: | |
| Regulog: | IolR2 - Corynebacteriaceae |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By TF family - LacI
- By pathway - Inositol utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | |||||
| cg0210 | iolR2 | -73 | 6.3 | CAATTGGAGCGCTCCAACAC | |
| cg0211 | iolG2 | -86 | 6.3 | GTGTTGGAGCGCTCCAATTG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |