Regulog IolR2 - Corynebacteriaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314
Corynebacterium glutamicum ATCC 13032	3	2
Corynebacterium jeikeium K411
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
iolG2	Corynebacterium amycolatum SK46	Corynebacterium aurimucosum ATCC 700975	Corynebacterium diphtheriae NCTC 13129	Corynebacterium efficiens YS-314	* Corynebacterium glutamicum ATCC 13032 Site: position = -86 score = 6.27568 sequence = GTGTTGGAGCGCTCCAATTG Gene: cg0211: Inositol 2-dehydrogenase (EC 1.1.1.18 )	Corynebacterium jeikeium K411	Corynebacterium kroppenstedtii DSM 44385	Corynebacterium urealyticum DSM 7109	Inositol 2-dehydrogenase (EC 1.1.1.18 )
iolE2	Corynebacterium amycolatum SK46	Corynebacterium aurimucosum ATCC 700975	Corynebacterium diphtheriae NCTC 13129	Corynebacterium efficiens YS-314	Corynebacterium glutamicum ATCC 13032 Gene: cg0212: Inosose dehydratase (EC 4.2.1.44)	Corynebacterium jeikeium K411	Corynebacterium kroppenstedtii DSM 44385	Corynebacterium urealyticum DSM 7109	Inosose dehydratase (EC 4.2.1.44)

CRON 2.
iolR2	Corynebacterium amycolatum SK46	Corynebacterium aurimucosum ATCC 700975	Corynebacterium diphtheriae NCTC 13129	Corynebacterium efficiens YS-314	* Corynebacterium glutamicum ATCC 13032 Site: position = -73 score = 6.27568 sequence = CAATTGGAGCGCTCCAACAC Gene: cg0210: Transcriptional regulator for inositol utilization, LacI family	Corynebacterium jeikeium K411	Corynebacterium kroppenstedtii DSM 44385	Corynebacterium urealyticum DSM 7109	Transcriptional regulator for inositol utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --