Profile of regulator MerR in Rhizobiales
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Regulog: | MerR - Rhizobiales |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Sinorhizobium meliloti 1021 | |||||
| SMa0280 | grxC | -66 | 5.7 | ACTCTGTACCATGCTACGGAAC | |
| Rhizobium sp. NGR234 | |||||
| NGR_c22270 | grxC | -65 | 6.4 | ACTCCGTACCATGGTACGGAAC | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |