Regulog MerR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | 1 | 1 |
| Rhizobium sp. NGR234 | 1 | 1 |
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium etli CFN 42 | ||
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Mesorhizobium sp. BNC1 | ||
| Mesorhizobium loti MAFF303099 | ||
| Brucella melitensis 16M | ||
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Azorhizobium caulinodans ORS 571 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| grxC |
*
Sinorhizobium meliloti 1021 Site: position = -66 score = 5.74264 sequence = ACTCTGTACCATGCTACGGAAC Gene: SMa0280: Glutaredoxin |
*
Rhizobium sp. NGR234 Site: position = -65 score = 6.36498 sequence = ACTCCGTACCATGGTACGGAAC Gene: NGR_c22270: Glutaredoxin |
|
|
|
|
|
|
|
|
|
|
|
|
|
Glutaredoxin |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |