Profile of regulator MerR in Pseudomonadaceae
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Regulog: | MerR - Pseudomonadaceae |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Pseudomonas stutzeri A1501 | |||||
| PST_3432 | merT | -61 | 6.8 | ATTCCGTACTTTGGTACGGAGT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |