Regulog MerR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | ||
| Pseudomonas entomophila L48 | ||
| Pseudomonas putida KT2440 | ||
| Pseudomonas syringae pv. tomato str. DC3000 | ||
| Pseudomonas fluorescens Pf-5 | ||
| Pseudomonas mendocina ymp | ||
| Pseudomonas stutzeri A1501 | 2 | 1 |
| Azotobacter vinelandii AvOP |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| merT |
|
|
|
|
|
|
*
Pseudomonas stutzeri A1501 Site: position = -61 score = 6.75485 sequence = ATTCCGTACTTTGGTACGGAGT Gene: PST_3432: Mercury uptake inner membane protein |
|
Mercury uptake inner membane protein |
| merP |
|
|
|
|
|
|
Gene: PST_3433: Periplasmic mercury(+2) binding protein |
|
Periplasmic mercury(+2) binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |