Regulog MerR - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Pseudomonas aeruginosa PAO1
Pseudomonas entomophila L48
Pseudomonas putida KT2440
Pseudomonas syringae pv. tomato str. DC3000
Pseudomonas fluorescens Pf-5
Pseudomonas mendocina ymp
Pseudomonas stutzeri A1501	2	1
Azotobacter vinelandii AvOP

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
merT	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	* Pseudomonas stutzeri A1501 Site: position = -61 score = 6.75485 sequence = ATTCCGTACTTTGGTACGGAGT Gene: PST_3432: Mercury uptake inner membane protein	Azotobacter vinelandii AvOP	Mercury uptake inner membane protein
merP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501 Gene: PST_3433: Periplasmic mercury(+2) binding protein	Azotobacter vinelandii AvOP	Periplasmic mercury(+2) binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --