Profile of regulator SoxR in Various betaproteobacteria
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Regulog: | SoxR - Various betaproteobacteria |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Chromobacterium violaceum ATCC 12472 | |||||
| CV2794 | wrbA | -58 | 5.2 | ACTTCAAGTTAACTTGAACT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |