Regulog SoxR - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Azoarcus sp. EbN1 | ||
| Thauera sp. MZ1T | ||
| Dechloromonas aromatica RCB | ||
| Nitrosomonas europaea ATCC 19718 | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | ||
| Chromobacterium violaceum ATCC 12472 | 2 | 1 |
| Neisseria meningitidis MC58 | ||
| Laribacter hongkongensis HLHK9 | ||
| Methylobacillus flagellatus KT | ||
| Methylotenera mobilis JLW8 | ||
| Methylophilales bacterium HTCC2181 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| wrbA |
|
|
|
|
|
|
*
Chromobacterium violaceum ATCC 12472 Site: position = -58 score = 5.22461 sequence = ACTTCAAGTTAACTTGAACT Gene: CV2794: Multimeric flavodoxin |
|
|
|
|
|
Multimeric flavodoxin |
| PF00903 |
|
|
|
|
|
|
Gene: CV2795: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
|
|
|
|
Glyoxalase/bleomycin resistance protein/dioxygenase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |