Profile of regulator MdxR in Streptococcaceae
| Regulator family: | LacI |
| Regulation mode: | activator |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Regulog: | MdxR - Streptococcaceae |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
- By pathway - Maltodextrin utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Streptococcus suis 05ZYH33 | |||||
| SSU05_2066 | mdxR | -78 | 6.4 | TAAAGAAAACGTTTGCACAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |