Regulog MdxR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | activator |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
- By pathway - Maltodextrin utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | ||
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | ||
| Streptococcus pneumoniae TIGR4 | ||
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | ||
| Streptococcus suis 05ZYH33 | 3 | 1 |
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| mdxR |
|
|
|
|
|
|
|
|
|
|
|
|
*
Streptococcus suis 05ZYH33 Site: position = -78 score = 6.36297 sequence = TAAAGAAAACGTTTGCACAA Gene: SSU05_2066: Predicted maltose/maltodextrin utilization transcriptional regulator MdxR, LacI family |
|
|
Predicted maltose/maltodextrin utilization transcriptional regulator MdxR, LacI family |
| pulA |
|
|
Gene: SAG1216: Pullulanase (EC 3.2.1.41) |
Gene: SDEG_0237: Pullulanase (EC 3.2.1.41) |
Gene: Sez_0820: Pullulanase (EC 3.2.1.41) |
Gene: GALLO_1462: Pullulanase (EC 3.2.1.41) |
|
Gene: smi_1848: Pullulanase (EC 3.2.1.41) |
Gene: SMU.910: Pullulanase (EC 3.2.1.41) |
Gene: SP_0268: Pullulanase (EC 3.2.1.41) |
Gene: SPy1972: Pullulanase (EC 3.2.1.41) |
Gene: SSA_0453: Pullulanase (EC 3.2.1.41) |
2
Streptococcus suis 05ZYH33 Gene: SSU05_2065: Pullulanase (EC 3.2.1.41) Gene: SSU05_2064: Pullulanase (EC 3.2.1.41) |
|
|
Pullulanase (EC 3.2.1.41) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |