Regulon of TM1030 in Thermotoga sp. RQ2

Properties
Regulator type:	Transcription factor
TF locus tag:	TRQ2_1778
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	TM1030 - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 7.1 Sequence: ATTTGACTGACCAGTCAATC Locus tag: TRQ2_1780 Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein Locus tag: TRQ2_1779 Name: TM1029 Funciton: Predicted ABC transport system, permease protein Locus tag: TRQ2_1778 Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family
	TRQ2_1780	TM1028	Predicted ABC transport system, ATP-binding protein
	TRQ2_1779	TM1029	Predicted ABC transport system, permease protein
	TRQ2_1778	TM1030	Predicted multidrug resistance transcription regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD