Regulon of TM1030 in Thermotoga sp. RQ2
| Regulator type: | Transcription factor |
| TF locus tag: | TRQ2_1778 |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | |
| Regulog: | TM1030 - Thermotogales |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - TetR
- By pathway - Multidrug resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -34
Score: 7.1 Sequence: ATTTGACTGACCAGTCAATC
Locus tag: TRQ2_1780
Name: TM1028 Funciton: Predicted ABC transport system, ATP-binding protein
Locus tag: TRQ2_1779
Name: TM1029 Funciton: Predicted ABC transport system, permease protein
Locus tag: TRQ2_1778
Name: TM1030 Funciton: Predicted multidrug resistance transcription regulator, TetR family |
|||
|
TM1028
|
Predicted ABC transport system, ATP-binding protein
|
||
|
TM1029
|
Predicted ABC transport system, permease protein
|
||
|
TM1030
|
Predicted multidrug resistance transcription regulator, TetR family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |