Statistics of regulated genes

Genome	Genes	Operons
Thermotoga maritima MSB8	3	1
Thermotoga sp. RQ2	3	1
Thermotoga neapolitana DSM 4359	4	1
Thermotoga petrophila RKU-1	3	1
Thermotoga naphthophila RKU-10	3	1
Thermotoga lettingae TMO	3	1
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes												Function
CRON 1.
CTN_1539	Thermotoga maritima MSB8	Thermotoga sp. RQ2	* Thermotoga neapolitana DSM 4359 Site: position = -63 score = 5.9413 sequence = GATTGACTCATTAGTCAATT Gene: CTN_1539: ABC transporter related precursor	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	ABC transporter related precursor
TM1028	* Thermotoga maritima MSB8 Site: position = -34 score = 7.09261 sequence = ATTTGACTGACCAGTCAATC Gene: TM1028: Predicted ABC transport system, ATP-binding protein	* Thermotoga sp. RQ2 Site: position = -34 score = 7.09261 sequence = ATTTGACTGACCAGTCAATC Gene: TRQ2_1780: Predicted ABC transport system, ATP-binding protein	Thermotoga neapolitana DSM 4359 Gene: CTN_1538: Predicted ABC transport system, ATP-binding protein	* Thermotoga petrophila RKU-1 Site: position = -34 score = 7.09261 sequence = ATTTGACTGACCAGTCAATC Gene: Tpet_1722: Predicted ABC transport system, ATP-binding protein	* Thermotoga naphthophila RKU-10 Site: position = -34 score = 7.09261 sequence = ATTTGACTGACCAGTCAATC Gene: Tnap_1736: Predicted ABC transport system, ATP-binding protein	* Thermotoga lettingae TMO Site: position = -65 score = 5.13666 sequence = TATTGACCACATGGTCAATA Gene: Tlet_1862: Predicted ABC transport system, ATP-binding protein	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted ABC transport system, ATP-binding protein
TM1029	Thermotoga maritima MSB8 Gene: TM1029: Predicted ABC transport system, permease protein	Thermotoga sp. RQ2 Gene: TRQ2_1779: Predicted ABC transport system, permease protein	Thermotoga neapolitana DSM 4359 Gene: CTN_1537: Predicted ABC transport system, permease protein	Thermotoga petrophila RKU-1 Gene: Tpet_1721: Predicted ABC transport system, permease protein	Thermotoga naphthophila RKU-10 Gene: Tnap_1735: Predicted ABC transport system, permease protein	Thermotoga lettingae TMO Gene: Tlet_1861: Predicted ABC transport system, permease protein	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted ABC transport system, permease protein
TM1030	Thermotoga maritima MSB8 Gene: TM1030: Predicted multidrug resistance transcription regulator, TetR family	Thermotoga sp. RQ2 Gene: TRQ2_1778: Predicted multidrug resistance transcription regulator, TetR family	Thermotoga neapolitana DSM 4359 Gene: CTN_1536: Predicted multidrug resistance transcription regulator, TetR family	Thermotoga petrophila RKU-1 Gene: Tpet_1720: Predicted multidrug resistance transcription regulator, TetR family	Thermotoga naphthophila RKU-10 Gene: Tnap_1734: Predicted multidrug resistance transcription regulator, TetR family	Thermotoga lettingae TMO Gene: Tlet_1860: Predicted multidrug resistance transcription regulator, TetR family	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted multidrug resistance transcription regulator, TetR family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD