Regulog TM1030 - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - TetR
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | 3 | 1 |
| Thermotoga sp. RQ2 | 3 | 1 |
| Thermotoga neapolitana DSM 4359 | 4 | 1 |
| Thermotoga petrophila RKU-1 | 3 | 1 |
| Thermotoga naphthophila RKU-10 | 3 | 1 |
| Thermotoga lettingae TMO | 3 | 1 |
| Thermosipho africanus TCF52B | ||
| Thermosipho melanesiensis BI429 | ||
| Fervidobacterium nodosum Rt17-B1 | ||
| Petrotoga mobilis SJ95 | ||
| Thermotogales bacterium TBF 19.5.1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| CTN_1539 |
|
|
*
Thermotoga neapolitana DSM 4359 Site: position = -63 score = 5.9413 sequence = GATTGACTCATTAGTCAATT Gene: CTN_1539: ABC transporter related precursor |
|
|
|
|
|
|
|
|
ABC transporter related precursor |
| TM1028 |
*
Thermotoga maritima MSB8 Site: position = -34 score = 7.09261 sequence = ATTTGACTGACCAGTCAATC Gene: TM1028: Predicted ABC transport system, ATP-binding protein |
*
Thermotoga sp. RQ2 Site: position = -34 score = 7.09261 sequence = ATTTGACTGACCAGTCAATC Gene: TRQ2_1780: Predicted ABC transport system, ATP-binding protein |
Gene: CTN_1538: Predicted ABC transport system, ATP-binding protein |
*
Thermotoga petrophila RKU-1 Site: position = -34 score = 7.09261 sequence = ATTTGACTGACCAGTCAATC Gene: Tpet_1722: Predicted ABC transport system, ATP-binding protein |
*
Thermotoga naphthophila RKU-10 Site: position = -34 score = 7.09261 sequence = ATTTGACTGACCAGTCAATC Gene: Tnap_1736: Predicted ABC transport system, ATP-binding protein |
*
Thermotoga lettingae TMO Site: position = -65 score = 5.13666 sequence = TATTGACCACATGGTCAATA Gene: Tlet_1862: Predicted ABC transport system, ATP-binding protein |
|
|
|
|
|
Predicted ABC transport system, ATP-binding protein |
| TM1029 |
Gene: TM1029: Predicted ABC transport system, permease protein |
Gene: TRQ2_1779: Predicted ABC transport system, permease protein |
Gene: CTN_1537: Predicted ABC transport system, permease protein |
Gene: Tpet_1721: Predicted ABC transport system, permease protein |
Gene: Tnap_1735: Predicted ABC transport system, permease protein |
Gene: Tlet_1861: Predicted ABC transport system, permease protein |
|
|
|
|
|
Predicted ABC transport system, permease protein |
| TM1030 |
Gene: TM1030: Predicted multidrug resistance transcription regulator, TetR family |
Gene: TRQ2_1778: Predicted multidrug resistance transcription regulator, TetR family |
Gene: CTN_1536: Predicted multidrug resistance transcription regulator, TetR family |
Gene: Tpet_1720: Predicted multidrug resistance transcription regulator, TetR family |
Gene: Tnap_1734: Predicted multidrug resistance transcription regulator, TetR family |
Gene: Tlet_1860: Predicted multidrug resistance transcription regulator, TetR family |
|
|
|
|
|
Predicted multidrug resistance transcription regulator, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |