Regulon of IolR in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_0203
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Regulog:	IolR - Thermotogales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By pathway - Inositol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 6.3 Sequence: GTTGGTTAGTAAATGAAAACAAA Locus tag: Tnap_0203 Name: iolR Funciton: Regulator of myo-inositol utilization InoR, ROK family Locus tag: Tnap_0204 Name: iolM Funciton: Inosose dehydrogenase Locus tag: Tnap_0205 Name: iolN Funciton: Keto-inosose hydrolase Locus tag: Tnap_0206 Name: iolG Funciton: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) Locus tag: Tnap_0207 Name: iolK Funciton: Novel inositol-related kinase, PfkB family (EC 2.7.1.12) Locus tag: Tnap_0208 Name: iolO Funciton: 5-keto-L-gluconate epimerase
	Tnap_0203	iolR	Regulator of myo-inositol utilization InoR, ROK family
	Tnap_0204	iolM	Inosose dehydrogenase
	Tnap_0205	iolN	Keto-inosose hydrolase
	Tnap_0206	iolG	Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
	Tnap_0207	iolK	Novel inositol-related kinase, PfkB family (EC 2.7.1.12)
	Tnap_0208	iolO	5-keto-L-gluconate epimerase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD