Regulog IolR - Thermotogales

Properties
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Phylum:	Thermotogae
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By pathway - Inositol utilization

Statistics of regulated genes
Genome	Genes	Operons
Thermotoga maritima MSB8	6	1
Thermotoga sp. RQ2
Thermotoga neapolitana DSM 4359	6	1
Thermotoga petrophila RKU-1	6	1
Thermotoga naphthophila RKU-10	6	1
Thermotoga lettingae TMO
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
iolR	* Thermotoga maritima MSB8 Site: position = -39 score = 6.01228 sequence = GTTGGTTAGTTAACGATAACAAA Gene: TM0411: Regulator of myo-inositol utilization InoR, ROK family	Thermotoga sp. RQ2	* Thermotoga neapolitana DSM 4359 Site: position = -40 score = 6.25205 sequence = GTTGGTTAGTAAATGAAAACAAA Gene: CTN_0258: Regulator of myo-inositol utilization InoR, ROK family	* Thermotoga petrophila RKU-1 Site: position = -40 score = 6.25205 sequence = GTTGGTTAGTAAATGAAAACAAA Gene: Tpet_0509: Regulator of myo-inositol utilization InoR, ROK family	* Thermotoga naphthophila RKU-10 Site: position = -40 score = 6.25205 sequence = GTTGGTTAGTAAATGAAAACAAA Gene: Tnap_0203: Regulator of myo-inositol utilization InoR, ROK family	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Regulator of myo-inositol utilization InoR, ROK family
iolM	Thermotoga maritima MSB8 Gene: TM0412: Inosose dehydrogenase	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0257: Inosose dehydrogenase	Thermotoga petrophila RKU-1 Gene: Tpet_0508: Inosose dehydrogenase	Thermotoga naphthophila RKU-10 Gene: Tnap_0204: Inosose dehydrogenase	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Inosose dehydrogenase
iolN	Thermotoga maritima MSB8 Gene: TM0413: Keto-inosose hydrolase	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0256: Keto-inosose hydrolase	Thermotoga petrophila RKU-1 Gene: Tpet_0507: Keto-inosose hydrolase	Thermotoga naphthophila RKU-10 Gene: Tnap_0205: Keto-inosose hydrolase	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Keto-inosose hydrolase
iolG	Thermotoga maritima MSB8 Gene: TM0414: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0255: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)	Thermotoga petrophila RKU-1 Gene: Tpet_0506: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)	Thermotoga naphthophila RKU-10 Gene: Tnap_0206: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
iolK	Thermotoga maritima MSB8 Gene: TM0415: Novel inositol-related kinase, PfkB family (EC 2.7.1.12)	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0254: Novel inositol-related kinase, PfkB family (EC 2.7.1.12)	Thermotoga petrophila RKU-1 Gene: Tpet_0505: Novel inositol-related kinase, PfkB family (EC 2.7.1.12)	Thermotoga naphthophila RKU-10 Gene: Tnap_0207: Novel inositol-related kinase, PfkB family (EC 2.7.1.12)	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Novel inositol-related kinase, PfkB family (EC 2.7.1.12)
iolO	Thermotoga maritima MSB8 Gene: TM0416: 5-keto-L-gluconate epimerase	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0253: 5-keto-L-gluconate epimerase	Thermotoga petrophila RKU-1 Gene: Tpet_0504: 5-keto-L-gluconate epimerase	Thermotoga naphthophila RKU-10 Gene: Tnap_0208: 5-keto-L-gluconate epimerase	Thermotoga lettingae TMO	Thermosipho africanus TCF52B	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	5-keto-L-gluconate epimerase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog IolR - Thermotogales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --