Regulon of GluR in Thermotoga petrophila RKU-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Tpet_0957
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Glucose utilization; Trehalose utilization
Effector:	Glucose
Regulog:	GluR - Thermotogales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Glucose
By pathway - Glucose utilization
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 6 Sequence: ATTTGATTATAACGTCATTTAAT Locus tag: Tpet_0953 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: Tpet_0954 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: Tpet_0955 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Tpet_0956 Name: treG Funciton: Trehalose ABC transporter, permease component 1 Locus tag: Tpet_0957 Name: gluR Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
	Tpet_0953	amyE	extracellular alpha-amylase precursor
	Tpet_0954	treE	Trehalose ABC transporter, substrate-binding component
	Tpet_0955	treF	Trehalose ABC transporter, permease component 1
	Tpet_0956	treG	Trehalose ABC transporter, permease component 1
	Tpet_0957	gluR	Predicted regulator of glucose and trehalose utilization, ROK family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD