Regulon of GluR in Thermotoga neapolitana DSM 4359

Properties
Regulator type:	Transcription factor
TF locus tag:	CTN_0774
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Glucose utilization; Trehalose utilization
Effector:	Glucose
Regulog:	GluR - Thermotogales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Glucose
By pathway - Glucose utilization
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 6.3 Sequence: ATTTGATTCCGTTGGAAATTAAT Locus tag: CTN_0777 Name: gluE Funciton: Glucose ABC transporter, substrate-binding component Locus tag: CTN_0776 Name: gluF Funciton: Glucose ABC transporter, permease component Locus tag: CTN_0775 Name: gluK Funciton: Glucose ABC transporter, ATP-binding component Locus tag: CTN_0774 Name: gluR Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
	CTN_0777	gluE	Glucose ABC transporter, substrate-binding component
	CTN_0776	gluF	Glucose ABC transporter, permease component
	CTN_0775	gluK	Glucose ABC transporter, ATP-binding component
	CTN_0774	gluR	Predicted regulator of glucose and trehalose utilization, ROK family
Position: -387 Score: 4.8 Sequence: ATTTgATTAtAccGTcAgTTAAc Locus tag: CTN_0781 Name: amyE Funciton: extracellular alpha-amylase precursor Locus tag: CTN_0780 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: CTN_0779 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: CTN_0778 Name: treG Funciton: Trehalose ABC transporter, permease component 1
	CTN_0781	amyE	extracellular alpha-amylase precursor
	CTN_0780	treE	Trehalose ABC transporter, substrate-binding component
	CTN_0779	treF	Trehalose ABC transporter, permease component 1
	CTN_0778	treG	Trehalose ABC transporter, permease component 1

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD