Regulon of GluR in Thermotoga neapolitana DSM 4359
| Regulator type: | Transcription factor |
| TF locus tag: | CTN_0774 |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Glucose utilization; Trehalose utilization |
| Effector: | Glucose |
| Regulog: | GluR - Thermotogales |
| Statistics of regulated genes: | |
| - Genes | 8 |
| - Operons | 2 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - ROK
- By effector - Glucose
- By pathway - Glucose utilization
- By pathway - Trehalose utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -121
Score: 6.3 Sequence: ATTTGATTCCGTTGGAAATTAAT
Locus tag: CTN_0777
Name: gluE Funciton: Glucose ABC transporter, substrate-binding component
Locus tag: CTN_0776
Name: gluF Funciton: Glucose ABC transporter, permease component
Locus tag: CTN_0775
Name: gluK Funciton: Glucose ABC transporter, ATP-binding component
Locus tag: CTN_0774
Name: gluR Funciton: Predicted regulator of glucose and trehalose utilization, ROK family |
|||
|
gluE
|
Glucose ABC transporter, substrate-binding component
|
||
|
gluF
|
Glucose ABC transporter, permease component
|
||
|
gluK
|
Glucose ABC transporter, ATP-binding component
|
||
|
gluR
|
Predicted regulator of glucose and trehalose utilization, ROK family
|
||
|
Position: -387
Score: 4.8 Sequence: ATTTgATTAtAccGTcAgTTAAc
Locus tag: CTN_0781
Name: amyE Funciton: extracellular alpha-amylase precursor
Locus tag: CTN_0780
Name: treE Funciton: Trehalose ABC transporter, substrate-binding component
Locus tag: CTN_0779
Name: treF Funciton: Trehalose ABC transporter, permease component 1
Locus tag: CTN_0778
Name: treG Funciton: Trehalose ABC transporter, permease component 1 |
|||
|
amyE
|
extracellular alpha-amylase precursor
|
||
|
treE
|
Trehalose ABC transporter, substrate-binding component
|
||
|
treF
|
Trehalose ABC transporter, permease component 1
|
||
|
treG
|
Trehalose ABC transporter, permease component 1
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |