Regulon of GluR in Thermotoga sp. RQ2

Properties
Regulator type:	Transcription factor
TF locus tag:	TRQ2_0976
Regulator family:	ROK
Regulation mode:	repressor
Biological process:	Glucose utilization; Trehalose utilization
Effector:	Glucose
Regulog:	GluR - Thermotogales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - ROK
By effector - Glucose
By pathway - Glucose utilization
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 6.3 Sequence: ATTTAATTCCTTTGGAAATTAAT Locus tag: TRQ2_0973 Name: gluE Funciton: Glucose ABC transporter, substrate-binding component Locus tag: TRQ2_0974 Name: gluF Funciton: Glucose ABC transporter, permease component Locus tag: TRQ2_0975 Name: gluK Funciton: Glucose ABC transporter, ATP-binding component Locus tag: TRQ2_0976 Name: gluR Funciton: Predicted regulator of glucose and trehalose utilization, ROK family
	TRQ2_0973	gluE	Glucose ABC transporter, substrate-binding component
	TRQ2_0974	gluF	Glucose ABC transporter, permease component
	TRQ2_0975	gluK	Glucose ABC transporter, ATP-binding component
	TRQ2_0976	gluR	Predicted regulator of glucose and trehalose utilization, ROK family
Position: -48 Score: 6 Sequence: ATTTGATTACAACGTCATTTAAC Locus tag: TRQ2_0970 Name: treE Funciton: Trehalose ABC transporter, substrate-binding component Locus tag: TRQ2_0971 Name: treF Funciton: Trehalose ABC transporter, permease component 1 Locus tag: TRQ2_0972 Name: treG Funciton: Trehalose ABC transporter, permease component 1
	TRQ2_0970	treE	Trehalose ABC transporter, substrate-binding component
	TRQ2_0971	treF	Trehalose ABC transporter, permease component 1
	TRQ2_0972	treG	Trehalose ABC transporter, permease component 1

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD