Regulon of Zur in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_1204
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Staphylococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 56 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6.4 Sequence: TAAAACGTAATGATTACGAATTG Locus tag: MCCL_0991 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	MCCL_0991	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -168 Score: 6.4 Sequence: CAATTCGTAATCATTACGTTTTA Position: -35 Score: 5.7 Sequence: TAAAACGTAACGATTACGAAATA Locus tag: MCCL_0992 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	MCCL_0992	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD