Regulon of Zur in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type:	Transcription factor
TF locus tag:	SSP1202
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Staphylococcaceae
Statistics of regulated genes:
- Genes	9
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 56 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.1 Sequence: TAATTCGGAAACATTACTATTTA Locus tag: SSP1200 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: SSP1201 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: SSP1202 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	SSP1200	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	SSP1201	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	SSP1202	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -36 Score: 6.9 Sequence: TAAATCGTAACAATTACTATTTA Locus tag: SSP0490 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	SSP0490	zinT	Candidate zinc-binding lipoprotein ZinT
Position: -168 Score: 7.3 Sequence: TAAATAGTAATTATTACGATTTA Locus tag: SSP0485 Name: SA2203 Funciton: putative MFS family major facilitator transporter
	SSP0485	SA2203	putative MFS family major facilitator transporter
Position: -40 Score: 7.4 Sequence: TAAATCGTAATTATTACGATTTA Locus tag: SSP1830 Name: SA0806 Funciton: hypothetical protein
	SSP1830	SA0806	hypothetical protein
Position: -43 Score: 6.9 Sequence: TAAAACGTAATAATTACGATTTG Locus tag: SSP1421 Name: rpsN2 Funciton: 30S ribosomal protein S14
	SSP1421	rpsN2	30S ribosomal protein S14
Position: -39 Score: 7.1 Sequence: TAAAACGTAATAATTACTATTTA Locus tag: SSP1422 Name: rpmG2 Funciton: 50S ribosomal protein L33
	SSP1422	rpmG2	50S ribosomal protein L33
Position: -35 Score: 5.2 Sequence: TTTAACGAAATAATTTCGATTTG Locus tag: SSP0388 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	SSP0388	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD