Regulon of Zur in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type:	Transcription factor
TF locus tag:	SH1362
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Staphylococcaceae
Statistics of regulated genes:
- Genes	12
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 56 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.2 Sequence: CAAGTCGTAAACATTACTATTTA Locus tag: SH1360 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: SH1361 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: SH1362 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	SH1360	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	SH1361	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	SH1362	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -188 Score: 7 Sequence: CAAATCGTAATTATTACTATTTA Position: -35 Score: 6.4 Sequence: TAAAACGTAATGATTTTGATTTA Locus tag: SH0125 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	SH0125	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -34 Score: 7.3 Sequence: TAAATCGTAATTATTACTATTTA Locus tag: SH0645 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	SH0645	zinT	Candidate zinc-binding lipoprotein ZinT
Position: -44 Score: 7.2 Sequence: TAAAACGTAATTATTACGATTTA Locus tag: SH0144 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	SH0144	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -254 Score: 6.4 Sequence: TAAATCAAAATCATTACGTTTTA Position: -101 Score: 7 Sequence: TAAATAGTAATAATTACGATTTG Locus tag: SH0124 Name: SA2368 Funciton: hypothetical protein
	SH0124	SA2368	hypothetical protein
Position: -120 Score: 7.3 Sequence: TAAATAGTAATTATTACGATTTA Locus tag: SH0638 Name: SA2203 Funciton: putative MFS family major facilitator transporter
	SH0638	SA2203	putative MFS family major facilitator transporter
Position: -42 Score: 7.2 Sequence: TAAATCGTAATTATTACGTTTTA Locus tag: SH2006 Name: SA0806 Funciton: hypothetical protein
	SH2006	SA0806	hypothetical protein
Position: -43 Score: 7.2 Sequence: TAAAACGTAATAATTACGATTTA Locus tag: SH1571 Name: rpsN2 Funciton: 30S ribosomal protein S14
	SH1571	rpsN2	30S ribosomal protein S14
Position: -43 Score: 6.5 Sequence: TAAATCGTAAGTATTCCTATTTA Locus tag: SH1572 Name: rpmG2 Funciton: 50S ribosomal protein L33
	SH1572	rpmG2	50S ribosomal protein L33
Position: -34 Score: 5.4 Sequence: AAAAACGAATTTATTACGTTTTG Locus tag: SH0551 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	SH0551	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Staphylococcus haemolyticus JCSC1435

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --