Regulon of Zur in Staphylococcus carnosus subsp. carnosus TM300

Properties
Regulator type:	Transcription factor
TF locus tag:	Sca_1175
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Staphylococcaceae
Statistics of regulated genes:
- Genes	12
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 56 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 6.2 Sequence: TTAATCGTAAGCATTACAATTTA Locus tag: Sca_1177 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Sca_1176 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: Sca_1175 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	Sca_1177	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Sca_1176	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	Sca_1175	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -58 Score: 7.1 Sequence: TAAATCGTAATTATTACGATTAA Locus tag: Sca_1955 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Sca_1955	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -51 Score: 6.1 Sequence: TAAATCGAAATCATTACGCTTAA Locus tag: Sca_0100 Name: Sca_0100 Funciton: putative alkylmercury lyase
	Sca_0100	Sca_0100	putative alkylmercury lyase
Position: -83 Score: 6.4 Sequence: TAAAACATAACGATTACGATTTA Locus tag: Sca_1906 Name: SA2370 Funciton: hypothetical protein Locus tag: Sca_1905 Name: SA2369 Funciton: hypothetical protein Locus tag: Sca_1904 Name: SA2368 Funciton: hypothetical protein
	Sca_1906	SA2370	hypothetical protein
	Sca_1905	SA2369	hypothetical protein
	Sca_1904	SA2368	hypothetical protein
Position: -36 Score: 7 Sequence: TAAATCGAAATTATTACGATTTA Locus tag: Sca_0550 Name: SA0806 Funciton: hypothetical protein
	Sca_0550	SA0806	hypothetical protein
Position: -54 Score: 6.7 Sequence: TAAATCGTAATAATTACGATTAT Locus tag: Sca_0977 Name: rpsN2 Funciton: 30S ribosomal protein S14
	Sca_0977	rpsN2	30S ribosomal protein S14
Position: -227 Score: 6.7 Sequence: ATAATCGTAATTATTACGATTTA Locus tag: Sca_0976 Name: rpmG2 Funciton: 50S ribosomal protein L33
	Sca_0976	rpmG2	50S ribosomal protein L33
Position: -40 Score: 6.3 Sequence: TAAACCATAATGATTACGATTTG Locus tag: Sca_1971 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Sca_1971	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Staphylococcus carnosus subsp. carnosus TM300

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --