Regulon of Zur in Staphylococcus capitis SK14

Properties
Regulator type:	Transcription factor
TF locus tag:	STACA0001_1792
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Staphylococcaceae
Statistics of regulated genes:
- Genes	11
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 56 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.1 Sequence: TTAGTCGTAAACATTACTATTTA Locus tag: STACA0001_1794 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: STACA0001_1793 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: STACA0001_1792 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	STACA0001_1794	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	STACA0001_1793	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	STACA0001_1792	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -34 Score: 7.3 Sequence: TAAATCGTAATAATTACTATTTA Locus tag: STACA0001_1070 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	STACA0001_1070	zinT	Candidate zinc-binding lipoprotein ZinT
Position: -43 Score: 7.1 Sequence: TAAAACGTAATAATTACTATTTA Locus tag: STACA0001_1465 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	STACA0001_1465	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -33 Score: 6.1 Sequence: TAAATCGTAATAATTTCGATTGG Locus tag: STACA0001_0760 Name: Sca_0100 Funciton: putative alkylmercury lyase
	STACA0001_0760	Sca_0100	putative alkylmercury lyase
Position: -145 Score: 7.3 Sequence: TAAATAGTAATTATTACGATTTA Locus tag: STACA0001_1062 Name: SA2203 Funciton: putative MFS family major facilitator transporter
	STACA0001_1062	SA2203	putative MFS family major facilitator transporter
Position: -52 Score: 6.8 Sequence: TAAATAGTAATTATTTCGATTTA Locus tag: STACA0001_0181 Name: SA0806 Funciton: hypothetical protein
	STACA0001_0181	SA0806	hypothetical protein
Position: -42 Score: 7.2 Sequence: TAAAACGTAATAATTACGATTTA Locus tag: STACA0001_1579 Name: rpsN2 Funciton: 30S ribosomal protein S14
	STACA0001_1579	rpsN2	30S ribosomal protein S14
Position: -43 Score: 5.3 Sequence: TAAATCGTAAGAATTCCTAACAA Locus tag: STACA0001_1578 Name: rpmG2 Funciton: 50S ribosomal protein L33
	STACA0001_1578	rpmG2	50S ribosomal protein L33
Position: -36 Score: 5.3 Sequence: ATAAACGAAATAATTACGCTTTG Locus tag: STACA0001_0989 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	STACA0001_0989	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Staphylococcus capitis SK14

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --