Regulon of Zur in Staphylococcus aureus subsp. aureus N315

Properties
Regulator type:	Transcription factor
TF locus tag:	SA1383
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Staphylococcaceae
Statistics of regulated genes:
- Genes	12
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 56 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -126 Score: 6.9 Sequence: TAAATAGTAATGATTACGTTTTA Locus tag: SA2203 Name: SA2203 Funciton: putative MFS family major facilitator transporter
	SA2203	SA2203	putative MFS family major facilitator transporter
Position: -42 Score: 6.4 Sequence: TAAATCGTAACGATTACGCTTTA Locus tag: SA0806 Name: SA0806 Funciton: hypothetical protein
	SA0806	SA0806	hypothetical protein
Position: -45 Score: 7.1 Sequence: TAAATCGTAATAATTACGATTTG Locus tag: SA1171 Name: rpsN2 Funciton: 30S ribosomal protein S14
	SA1171	rpsN2	30S ribosomal protein S14
Position: -38 Score: 5.4 Sequence: TAAATCGTAAAGATTCCTAACAA Locus tag: SAS042 Name: rpmG2 Funciton: 50S ribosomal protein L33
	SAS042	rpmG2	50S ribosomal protein L33
Position: -69 Score: 5.5 Sequence: TGAGTCGTAAACATTACTGTTTA Locus tag: SA1385 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: SA1384 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: SA1383 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	SA1385	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	SA1384	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	SA1383	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -34 Score: 6.6 Sequence: TAAAACGTAAAGATTACTATTTA Locus tag: SA2194 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	SA2194	zinT	Candidate zinc-binding lipoprotein ZinT
Position: -50 Score: 6.4 Sequence: TAAAACGGAATTATTCCTATTTA Locus tag: SA0410 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	SA0410	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -69 Score: 7.4 Sequence: TAAATCGTAATTATTACGATTTA Locus tag: SA2370 Name: SA2370 Funciton: hypothetical protein Locus tag: SA2369 Name: SA2369 Funciton: hypothetical protein Locus tag: SA2368 Name: SA2368 Funciton: hypothetical protein
	SA2370	SA2370	hypothetical protein
	SA2369	SA2369	hypothetical protein
	SA2368	SA2368	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Staphylococcus aureus subsp. aureus N315

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --