Regulon of PhrR in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type:	Transcription factor
TF locus tag:	ASA_3231
Regulator family:	MerR
Regulation mode:	repressor
Biological process:	Light-dependent DNA repair
Effector:	Adenosylcobalamin; Blue light
Regulog:	PhrR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	12
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - PhrR
By TF family - MerR
By effector - Adenosylcobalamin
By effector - Blue light
By pathway - Light-dependent DNA repair

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 5.9 Sequence: TATACAGCTTCCATTATTTTGTATA Position: -18 Score: 6 Sequence: TATACAAGGAGTGCCAACATGTACA Locus tag: ASA_3232 Name: COG3272 Funciton: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA Locus tag: ASA_3231 Name: phrR Funciton: Transcriptional regulator, MerR family, associated with photolyase Locus tag: ASA_3230 Name: phr Funciton: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) Locus tag: ASA_3229 Name: PF10184 Funciton: Protein of unknown function DUF2358 Locus tag: ASA_3228 Name: PF00106 Funciton: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) Locus tag: ASA_3227 Name: PF01593 Funciton: Flavin containing amine oxidoreductase Locus tag: ASA_3226 Name: PF07103 Funciton: Protein of unknown function DUF1365 Locus tag: ASA_3225 Name: PF02353 Funciton: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase Locus tag: ASA_3224 Name: PF11086 Funciton: Protein of unknown function DUF2878 Locus tag: ASA_3223 Name: PF09493 Funciton: Tryptophan-rich protein (DUF2389) Locus tag: ASA_3222 Name: FIG026291 Funciton: FIG026291: Hypothetical periplasmic protein Locus tag: ASA_3221 Name: FIG002577 Funciton: FIG002577: Putative lipoprotein precursor
	ASA_3232	COG3272	COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
	ASA_3231	phrR	Transcriptional regulator, MerR family, associated with photolyase
	ASA_3230	phr	Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
	ASA_3229	PF10184	Protein of unknown function DUF2358
	ASA_3228	PF00106	Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
	ASA_3227	PF01593	Flavin containing amine oxidoreductase
	ASA_3226	PF07103	Protein of unknown function DUF1365
	ASA_3225	PF02353	S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
	ASA_3224	PF11086	Protein of unknown function DUF2878
	ASA_3223	PF09493	Tryptophan-rich protein (DUF2389)
	ASA_3222	FIG026291	FIG026291: Hypothetical periplasmic protein
	ASA_3221	FIG002577	FIG002577: Putative lipoprotein precursor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD