Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog PhrR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: repressor
Biological process: Light-dependent DNA repair
Effector: Adenosylcobalamin; Blue light
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Aeromonas hydrophila subsp. hydrophila ATCC 7966 8 1
Aeromonas salmonicida subsp. salmonicida A449 12 1
Tolumonas auensis DSM 9187
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Moritella sp. PE36
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG3272
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -65
score = 6.48324
sequence = TATACAACTTACAATTTTTTGTATA

Site:
position = -18
score = 6.06335
sequence = TATACAAGGAGTGATGATATGTACA

Gene: AHA_1099: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -18
score = 6.01495
sequence = TATACAAGGAGTGCCAACATGTACA

Site:
position = -75
score = 5.85077
sequence = TATACAGCTTCCATTATTTTGTATA

Gene: ASA_3232: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Tolumonas auensis DSM 9187

Gene: Tola_1113: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Psychromonas ingrahamii 37

Gene: Ping_0997: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA
phrR
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1100: Transcriptional regulator, MerR family, associated with photolyase
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3231: Transcriptional regulator, MerR family, associated with photolyase
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
Transcriptional regulator, MerR family, associated with photolyase
phr
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1101: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3230: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Tolumonas auensis DSM 9187

Gene: Tola_1114: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Psychromonas ingrahamii 37

Gene: Ping_0998: Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
Deoxyribodipyrimidine photolyase (EC 4.1.99.3)
PF10184
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1102: Protein of unknown function DUF2358
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3229: Protein of unknown function DUF2358
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37

Gene: Ping_0999: Protein of unknown function DUF2358
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
Protein of unknown function DUF2358
PF00106
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1103: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3228: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37

Gene: Ping_1000: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-)
PF01593
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1104: Flavin containing amine oxidoreductase
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3227: Flavin containing amine oxidoreductase
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37

Gene: Ping_1001: Flavin containing amine oxidoreductase
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
Flavin containing amine oxidoreductase
PF07103
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1105: Protein of unknown function DUF1365
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3226: Protein of unknown function DUF1365
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37

Gene: Ping_1002: Protein of unknown function DUF1365
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
Protein of unknown function DUF1365
PF02353
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1106: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3225: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37

Gene: Ping_1003: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase
PF11086
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3224: Protein of unknown function DUF2878
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37

Gene: Ping_1004: Protein of unknown function DUF2878
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
Protein of unknown function DUF2878
PF09493
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1107: Tryptophan-rich protein (DUF2389)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3223: Tryptophan-rich protein (DUF2389)
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37

Gene: Ping_1886: Tryptophan-rich protein (DUF2389)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
Tryptophan-rich protein (DUF2389)
FIG026291
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1108: FIG026291: Hypothetical periplasmic protein
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3222: FIG026291: Hypothetical periplasmic protein
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37

Gene: Ping_1005: FIG026291: Hypothetical periplasmic protein
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
FIG026291: Hypothetical periplasmic protein
FIG002577
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1109: FIG002577: Putative lipoprotein precursor
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_3221: FIG002577: Putative lipoprotein precursor
 
Tolumonas auensis DSM 9187
 
Psychromonas ingrahamii 37

Gene: Ping_1006: FIG002577: Putative lipoprotein precursor
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
FIG002577: Putative lipoprotein precursor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD