Regulog PhrR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | repressor |
| Biological process: | Light-dependent DNA repair |
| Effector: | Adenosylcobalamin; Blue light |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - PhrR
- By TF family - MerR
- By effector - Adenosylcobalamin
- By effector - Blue light
- By pathway - Light-dependent DNA repair
| Genome | Genes | Operons |
|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 8 | 1 |
| Aeromonas salmonicida subsp. salmonicida A449 | 12 | 1 |
| Tolumonas auensis DSM 9187 | ||
| Psychromonas ingrahamii 37 | ||
| Psychromonas sp. CNPT3 | ||
| Moritella sp. PE36 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| COG3272 |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -65 score = 6.48324 sequence = TATACAACTTACAATTTTTTGTATA Site: position = -18 score = 6.06335 sequence = TATACAAGGAGTGATGATATGTACA Gene: AHA_1099: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -18 score = 6.01495 sequence = TATACAAGGAGTGCCAACATGTACA Site: position = -75 score = 5.85077 sequence = TATACAGCTTCCATTATTTTGTATA Gene: ASA_3232: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
Gene: Tola_1113: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
Gene: Ping_0997: COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
|
|
COG1683: Uncharacterized conserved protein / COG3272: Hypothetical protein YbgA |
| phrR |
Gene: AHA_1100: Transcriptional regulator, MerR family, associated with photolyase |
Gene: ASA_3231: Transcriptional regulator, MerR family, associated with photolyase |
|
|
|
|
Transcriptional regulator, MerR family, associated with photolyase |
| phr |
Gene: AHA_1101: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: ASA_3230: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: Tola_1114: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
Gene: Ping_0998: Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
|
|
Deoxyribodipyrimidine photolyase (EC 4.1.99.3) |
| PF10184 |
Gene: AHA_1102: Protein of unknown function DUF2358 |
Gene: ASA_3229: Protein of unknown function DUF2358 |
|
Gene: Ping_0999: Protein of unknown function DUF2358 |
|
|
Protein of unknown function DUF2358 |
| PF00106 |
Gene: AHA_1103: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
Gene: ASA_3228: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
|
Gene: Ping_1000: Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
|
|
Oxidoreductase, short-chain dehydrogenase/reductase family (EC 1.1.1.-) |
| PF01593 |
Gene: AHA_1104: Flavin containing amine oxidoreductase |
Gene: ASA_3227: Flavin containing amine oxidoreductase |
|
Gene: Ping_1001: Flavin containing amine oxidoreductase |
|
|
Flavin containing amine oxidoreductase |
| PF07103 |
Gene: AHA_1105: Protein of unknown function DUF1365 |
Gene: ASA_3226: Protein of unknown function DUF1365 |
|
Gene: Ping_1002: Protein of unknown function DUF1365 |
|
|
Protein of unknown function DUF1365 |
| PF02353 |
Gene: AHA_1106: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
Gene: ASA_3225: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
|
Gene: Ping_1003: S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
|
|
S-adenosyl-L-methionine dependent methyltransferase, similar to cyclopropane-fatty-acyl-phospholipid synthase |
| PF11086 |
|
Gene: ASA_3224: Protein of unknown function DUF2878 |
|
Gene: Ping_1004: Protein of unknown function DUF2878 |
|
|
Protein of unknown function DUF2878 |
| PF09493 |
Gene: AHA_1107: Tryptophan-rich protein (DUF2389) |
Gene: ASA_3223: Tryptophan-rich protein (DUF2389) |
|
Gene: Ping_1886: Tryptophan-rich protein (DUF2389) |
|
|
Tryptophan-rich protein (DUF2389) |
| FIG026291 |
Gene: AHA_1108: FIG026291: Hypothetical periplasmic protein |
Gene: ASA_3222: FIG026291: Hypothetical periplasmic protein |
|
Gene: Ping_1005: FIG026291: Hypothetical periplasmic protein |
|
|
FIG026291: Hypothetical periplasmic protein |
| FIG002577 |
Gene: AHA_1109: FIG002577: Putative lipoprotein precursor |
Gene: ASA_3221: FIG002577: Putative lipoprotein precursor |
|
Gene: Ping_1006: FIG002577: Putative lipoprotein precursor |
|
|
FIG002577: Putative lipoprotein precursor |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |