Regulon of HrcA in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_1146
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Bifidobacteriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -140 Score: 7.2 Sequence: TTGGCACTCGAGGCCCGAGAGTGCTAA Position: -104 Score: 7.2 Sequence: TTAGCACTCGAGGAGTGAGAGTGATAA Locus tag: BDP_0772 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	BDP_0772	groL	Heat shock protein 60 family chaperone GroEL
Position: -138 Score: 6.9 Sequence: TTAGCACTCCTCGGCCGGGAGTGCTAA Locus tag: BDP_1146 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: BDP_1147 Name: dnaJ Funciton: Chaperone protein DnaJ
	BDP_1146	hrcA	Heat-inducible transcription repressor HrcA
	BDP_1147	dnaJ	Chaperone protein DnaJ
Position: -147 Score: 7.4 Sequence: TTAGCACTCGAGTTGGCAGAGTGCTAA Locus tag: BDP_0405 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES
	BDP_0405	groS	Heat shock protein 60 family co-chaperone GroES

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD