Regulon of HrcA in Bifidobacterium animalis subsp. lactis AD011

Properties
Regulator type:	Transcription factor
TF locus tag:	BLA_1356
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Bifidobacteriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -116 Score: 7.1 Sequence: TTGGCACTCGACCACTGAGAGTGCTAA Locus tag: BLA_1183 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	BLA_1183	groL	Heat shock protein 60 family chaperone GroEL
Position: -137 Score: 7.4 Sequence: TTAGCACTCGAGTTGGCAGAGTGCTAA Locus tag: BLA_0343 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES
	BLA_0343	groS	Heat shock protein 60 family co-chaperone GroES
Position: -62 Score: 6.9 Sequence: TTAGCACTCCTGTATGCAGAGTGCTAA Locus tag: BLA_1356 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: BLA_1355 Name: dnaJ Funciton: Chaperone protein DnaJ
	BLA_1356	hrcA	Heat-inducible transcription repressor HrcA
	BLA_1355	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD