Regulon of HrcA in Bifidobacterium angulatum DSM 20098

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFANG_01435
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 39 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Bifidobacteriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 7.2 Sequence: TTGGCACTCTCGCACCTTGAGTGCTAA Position: -60 Score: 7.1 Sequence: TTAGCACTCAAGGTGCGAGAGTGATAA Locus tag: BIFANG_00586 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	BIFANG_00586	groL	Heat shock protein 60 family chaperone GroEL
Position: -142 Score: 7.4 Sequence: TTAGCACTCGAGTTGGCAGAGTGCTAA Locus tag: BIFANG_00124 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES
	BIFANG_00124	groS	Heat shock protein 60 family co-chaperone GroES

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD