Regulon of SgaR2 in Bifidobacterium bifidum NCIMB 41171

Properties
Regulator type:	Transcription factor
TF locus tag:	BbifN4_010100009105
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR2 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -137 Score: 5.6 Sequence: TTGAGAAATCGGTTTCCGGG Locus tag: BbifN4_010100009110 Name: sgaA2 Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69) Locus tag: BbifN4_010100009115 Name: sgaB2 Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: BbifN4_010100009120 Name: sgaT2 Funciton: Ascorbate-specific PTS, EIIC component
	BbifN4_010100009110	sgaA2	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69)
	BbifN4_010100009115	sgaB2	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	BbifN4_010100009120	sgaT2	Ascorbate-specific PTS, EIIC component
Position: -212 Score: 5.6 Sequence: CCCGGAAACCGATTTCTCAA Locus tag: BbifN4_010100009105 Name: sgaR2 Funciton: Predicted transcriptional regulator of ascorbate utilization, LacI family
	BbifN4_010100009105	sgaR2	Predicted transcriptional regulator of ascorbate utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD