Regulog SgaR2 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ascorbate utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Ascorbate-6-phosphate
- By pathway - Ascorbate utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | 4 | 2 |
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | ||
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Gardnerella vaginalis 409-05 | 7 | 2 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| ptsI |
Gene: BAD_0166: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
Gene: BIFANG_00108: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
Gene: BbifN4_010100006908: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
Gene: BIFBRE_01978: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
Gene: BDP_0254: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
Gene: BIFGAL_00157: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
Gene: Blon_0178: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
*
Gardnerella vaginalis 409-05 Site: position = -140 score = 6.05283 sequence = TACAGAAAACGTTTTCACTT Gene: HMPREF0424_1268: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
| sgaA2 |
|
|
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -137 score = 5.57763 sequence = TTGAGAAATCGGTTTCCGGG Gene: BbifN4_010100009110: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69) |
|
|
|
|
|
Gene: HMPREF0424_1267: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69) |
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.69) |
| sgaB2 |
|
|
|
Gene: BbifN4_010100009115: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
|
|
|
|
|
Gene: HMPREF0424_1266: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
| HMPREF0424_1265 |
|
|
|
|
|
|
|
|
|
Gene: HMPREF0424_1265: putative lipoprotein |
putative lipoprotein |
| sgaT2 |
|
|
|
Gene: BbifN4_010100009120: Ascorbate-specific PTS, EIIC component |
|
|
|
|
|
Gene: HMPREF0424_1264: Ascorbate-specific PTS, EIIC component |
Ascorbate-specific PTS, EIIC component |
| CRON 2. | |||||||||||
| hpr |
|
Gene: BIFANG_00109: Phosphotransferase system, phosphocarrier protein HPr |
|
Gene: BbifN4_010100006903: Phosphotransferase system, phosphocarrier protein HPr |
Gene: BIFBRE_01976: Phosphotransferase system, phosphocarrier protein HPr |
Gene: BDP_0253: Phosphotransferase system, phosphocarrier protein HPr |
Gene: BIFGAL_00155: Phosphotransferase system, phosphocarrier protein HPr |
|
Gene: Blon_0177: Phosphotransferase system, phosphocarrier protein HPr |
*
Gardnerella vaginalis 409-05 Site: position = -153 score = 6.05283 sequence = AAGTGAAAACGTTTTCTGTA Gene: HMPREF0424_1269: Phosphotransferase system, phosphocarrier protein HPr |
Phosphotransferase system, phosphocarrier protein HPr |
| sgaR2 |
|
|
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -212 score = 5.57763 sequence = CCCGGAAACCGATTTCTCAA Gene: BbifN4_010100009105: Predicted transcriptional regulator of ascorbate utilization, LacI family |
|
|
|
|
|
Gene: HMPREF0424_1270: Predicted transcriptional regulator of ascorbate utilization, LacI family |
Predicted transcriptional regulator of ascorbate utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |