Profile of regulator SgaR2 in Bifidobacteriaceae
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ascorbate utilization |
| Effector: | Ascorbate-6-phosphate |
| Regulog: | SgaR2 - Bifidobacteriaceae |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Ascorbate-6-phosphate
- By pathway - Ascorbate utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bifidobacterium bifidum NCIMB 41171 | |||||
| BbifN4_010100009105 | sgaR2 | -212 | 5.6 | CCCGGAAACCGATTTCTCAA | |
| BbifN4_010100009110 | sgaA2 | -137 | 5.6 | TTGAGAAATCGGTTTCCGGG | |
| Gardnerella vaginalis 409-05 | |||||
| HMPREF0424_1268 | ptsI | -140 | 6.1 | TACAGAAAACGTTTTCACTT | |
| HMPREF0424_1269 | hpr | -153 | 6.1 | AAGTGAAAACGTTTTCTGTA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |