Regulon of XylR in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type:	Transcription factor
TF locus tag:	Blon_0573
Regulator family:	ROK
Regulation mode:
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - ROK
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -166 Score: 5.5 Sequence: ATAAGTTAGACGATTAAACTATA Locus tag: Blon_0573 Name: xylR Funciton: Xylose repressor XylR, ROK family
	Blon_0573	xylR	Xylose repressor XylR, ROK family
Position: -76 Score: 5.5 Sequence: TATAGTTTAATCGTCTAACTTAT Locus tag: Blon_0572 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
	Blon_0572	xylB	Xylulose kinase (EC 2.7.1.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD