Regulon of NagR in Bifidobacterium bifidum NCIMB 41171

Properties
Regulator type:	Transcription factor
TF locus tag:	BbifN4_010100002379, BbifN4_010100004909
Regulator family:	ROK
Regulation mode:
Biological process:	Lacto-N-biose utilization; Galacto-N-biose utilization
Effector:	N-acetylglucosamine-6-phosphate
Regulog:	NagR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - ROK
By effector - N-acetylglucosamine-6-phosphate
By pathway - Lacto-N-biose utilization
By pathway - Galacto-N-biose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -168 Score: 4.9 Sequence: ATTTGTTAATTATAGTTACATAA Locus tag: BbifN4_010100004909 Name: nagR Funciton: Transciptional regulator of lacto-N-biose and galacto-N-biose utilization, ROK family
	BbifN4_010100004909	nagR	Transciptional regulator of lacto-N-biose and galacto-N-biose utilization, ROK family
Position: -101 Score: 4.7 Sequence: AAATGTTAATGTAGTTGACATTT Locus tag: BbifN4_010100004949 Name: lnbA Funciton: Predicted galacto-N-biose-/lacto-N-biose ABC transporter, substrate-binding protein Locus tag: BbifN4_010100004944 Name: lnbB Funciton: Predicted galacto-N-biose-/lacto-N-biose ABC transporter, permease component 1 Locus tag: BbifN4_010100004939 Name: lnbC Funciton: Predicted galacto-N-biose-/lacto-N-biose ABC transporter, permease component 2
	BbifN4_010100004949	lnbA	Predicted galacto-N-biose-/lacto-N-biose ABC transporter, substrate-binding protein
	BbifN4_010100004944	lnbB	Predicted galacto-N-biose-/lacto-N-biose ABC transporter, permease component 1
	BbifN4_010100004939	lnbC	Predicted galacto-N-biose-/lacto-N-biose ABC transporter, permease component 2
Position: -135 Score: 6.3 Sequence: ATTAGTTAGTATCATTAACAAAT Locus tag: BbifN4_010100002384 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) Locus tag: BbifN4_010100002389 Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
	BbifN4_010100002384	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	BbifN4_010100002389	nagA	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Position: -138 Score: 6.3 Sequence: ATTTGTTAATGATACTAACTAAT Locus tag: BbifN4_010100002379 Name: nagR Funciton: Transciptional regulator of lacto-N-biose and galacto-N-biose utilization, ROK family
	BbifN4_010100002379	nagR	Transciptional regulator of lacto-N-biose and galacto-N-biose utilization, ROK family
Position: -144 Score: 4.9 Sequence: TTATGTAACTATAATTAACAAAT Locus tag: BbifN4_010100004904 Name: nahK Funciton: N-acetylhexosamine 1-kinase (EC:2.7.1.162) Locus tag: BbifN4_010100004899 Name: galT2 Funciton: UDP-glucose--hexose-1-phosphate uridylyltransferase (EC:2.7.7.12) Locus tag: BbifN4_010100004894 Name: galE2 Funciton: UDP-glucose 4-epimerase (EC 5.1.3.2)
	BbifN4_010100004904	nahK	N-acetylhexosamine 1-kinase (EC:2.7.1.162)
	BbifN4_010100004899	galT2	UDP-glucose--hexose-1-phosphate uridylyltransferase (EC:2.7.7.12)
	BbifN4_010100004894	galE2	UDP-glucose 4-epimerase (EC 5.1.3.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD