Regulon of CldR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_0136
Regulator family:	LacI
Regulation mode:
Biological process:	Cellodextrin utilization
Effector:	Cellobiose
Regulog:	CldR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Cellobiose
By pathway - Cellodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -181 Score: 4.4 Sequence: ACGCTGGAATCGTTTCCAAAAG Locus tag: BDP_0136 Name: cldR Funciton: Cellodextrin utilization transcriptional regulator, LacI family
	BDP_0136	cldR	Cellodextrin utilization transcriptional regulator, LacI family
Position: -173 Score: 5.6 Sequence: TTGATGGAAACGGTTCCATCAA Locus tag: BDP_0137 Name: cldE Funciton: ABC-type cellodextrin transport system, substrate-binding component Locus tag: BDP_0138 Name: cldF Funciton: ABC-type cellodextrin transport system, permease component Locus tag: BDP_0139 Name: cldG Funciton: ABC-type cellodextrin transport system, permease component
	BDP_0137	cldE	ABC-type cellodextrin transport system, substrate-binding component
	BDP_0138	cldF	ABC-type cellodextrin transport system, permease component
	BDP_0139	cldG	ABC-type cellodextrin transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD