Regulog CldR - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Cellodextrin utilization |
| Effector: | Cellobiose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Cellobiose
- By pathway - Cellodextrin utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | 4 | 2 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| cldR |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -181 score = 4.43473 sequence = ACGCTGGAATCGTTTCCAAAAG Gene: BDP_0136: Cellodextrin utilization transcriptional regulator, LacI family |
|
|
|
Cellodextrin utilization transcriptional regulator, LacI family |
| CRON 2. | |||||||||||
| cldE |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -173 score = 5.59545 sequence = TTGATGGAAACGGTTCCATCAA Gene: BDP_0137: ABC-type cellodextrin transport system, substrate-binding component |
|
|
|
ABC-type cellodextrin transport system, substrate-binding component |
| cldF |
|
|
|
|
|
|
Gene: BDP_0138: ABC-type cellodextrin transport system, permease component |
|
|
|
ABC-type cellodextrin transport system, permease component |
| cldG |
|
|
|
|
|
|
Gene: BDP_0139: ABC-type cellodextrin transport system, permease component |
|
|
|
ABC-type cellodextrin transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |