Profile of regulator CldR in Bifidobacteriaceae
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Cellodextrin utilization |
| Effector: | Cellobiose |
| Regulog: | CldR - Bifidobacteriaceae |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Cellobiose
- By pathway - Cellodextrin utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | |||||
| BDP_0136 | cldR | -181 | 4.4 | ACGCTGGAATCGTTTCCAAAAG | |
| BDP_0137 | cldE | -173 | 5.6 | TTGATGGAAACGGTTCCATCAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |