Regulon of BIFBRE_03542 in Bifidobacterium breve DSM 20213

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFBRE_00877
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BIFBRE_03542 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -275 Score: 6.8 Sequence: TGCTGAGAACGCTCCCAATA Position: -137 Score: 6.8 Sequence: CACTGGGAGCGCTCCGAAGA Locus tag: BIFBRE_00875 Name: null Funciton: ABC-type sugar transporter, permease component Locus tag: BIFBRE_00874 Name: null Funciton: ABC-type sugar transporter, permease component Locus tag: BIFBRE_00873 Name: null Funciton: ABC-type sugar transporter, substrate-binding component
	BIFBRE_00875		ABC-type sugar transporter, permease component
	BIFBRE_00874		ABC-type sugar transporter, permease component
	BIFBRE_00873		ABC-type sugar transporter, substrate-binding component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD