Profile of regulator BIFBRE_03542 in Bifidobacteriaceae
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Regulog: | BIFBRE_03542 - Bifidobacteriaceae |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bifidobacterium breve DSM 20213 | |||||
| BIFBRE_00875 | null | -275 | 6.8 | TGCTGAGAACGCTCCCAATA | |
| BIFBRE_00875 | null | -137 | 6.8 | CACTGGGAGCGCTCCGAAGA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |