Regulog BIFBRE_03542 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 3 | 1 |
| Bifidobacterium dentium Bd1 | ||
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| Blon_2369 |
Gene: Blon_2369: ABC-type sugar transporter, permease component |
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -275 score = 6.84977 sequence = TGCTGAGAACGCTCCCAATA Site: position = -137 score = 6.84977 sequence = CACTGGGAGCGCTCCGAAGA Gene: BIFBRE_00875: ABC-type sugar transporter, permease component |
|
|
|
|
ABC-type sugar transporter, permease component |
| Blon_2368 |
Gene: Blon_2368: ABC-type sugar transporter, permease component |
|
|
|
|
Gene: BIFBRE_00874: ABC-type sugar transporter, permease component |
|
|
|
|
ABC-type sugar transporter, permease component |
| Blon_2367 |
Gene: Blon_2367: ABC-type sugar transporter, substrate-binding component |
|
|
|
|
Gene: BIFBRE_00873: ABC-type sugar transporter, substrate-binding component |
|
|
|
|
ABC-type sugar transporter, substrate-binding component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |