Regulon of RafR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_2227
Regulator family:	ROK
Regulation mode:	activator
Biological process:	Raffinose utilization
Effector:
Regulog:	RafR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - ROK
By pathway - Raffinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -115 Score: 5.3 Sequence: GATTTTGTTATTCTGAGAAAGTA Locus tag: BDP_2227 Name: rafR Funciton: Raffinose utilization transcriptional regulator, ROK family
	BDP_2227	rafR	Raffinose utilization transcriptional regulator, ROK family
Position: -106 Score: 5.3 Sequence: TACTTTCCGAAAATAAGAAACAC Locus tag: BDP_2229 Name: agaL Funciton: Alpha-galactosidase (EC 3.2.1.22)
	BDP_2229	agaL	Alpha-galactosidase (EC 3.2.1.22)
Position: -159 Score: 5.3 Sequence: TACTTTCTCAGAATAACAAAATC Locus tag: BDP_2226 Name: rafB Funciton: Raffinose ABC transporter, substrate-binding protein Locus tag: BDP_2225 Name: rafC Funciton: Raffinose ABC transporter, permease protein 1 Locus tag: BDP_2224 Name: rafD Funciton: Raffinose ABC transporter, permease protein 2
	BDP_2226	rafB	Raffinose ABC transporter, substrate-binding protein
	BDP_2225	rafC	Raffinose ABC transporter, permease protein 1
	BDP_2224	rafD	Raffinose ABC transporter, permease protein 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD