Regulon of RafR in Bifidobacterium adolescentis ATCC 15703

Properties
Regulator type:	Transcription factor
TF locus tag:	BAD_1575
Regulator family:	ROK
Regulation mode:	activator
Biological process:	Raffinose utilization
Effector:
Regulog:	RafR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - ROK
By pathway - Raffinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -161 Score: 5.5 Sequence: TACTTTCCAAGAATAACAAAATA Locus tag: BAD_1574 Name: rafB Funciton: Raffinose ABC transporter, substrate-binding protein Locus tag: BAD_1573 Name: rafC Funciton: Raffinose ABC transporter, permease protein 1 Locus tag: BAD_1572 Name: rafD Funciton: Raffinose ABC transporter, permease protein 2
	BAD_1574	rafB	Raffinose ABC transporter, substrate-binding protein
	BAD_1573	rafC	Raffinose ABC transporter, permease protein 1
	BAD_1572	rafD	Raffinose ABC transporter, permease protein 2
Position: -47 Score: 5.5 Sequence: TATTTTGTTATTCTTGGAAAGTA Locus tag: BAD_1575 Name: rafR Funciton: Raffinose utilization transcriptional regulator, ROK family
	BAD_1575	rafR	Raffinose utilization transcriptional regulator, ROK family
Position: -104 Score: 5 Sequence: TACTTTCCGAAAGAAACAAACAC Locus tag: BAD_1576 Name: agaL Funciton: Alpha-galactosidase (EC 3.2.1.22)
	BAD_1576	agaL	Alpha-galactosidase (EC 3.2.1.22)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD