Regulon of RafR in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type:	Transcription factor
TF locus tag:	Blon_2459
Regulator family:	ROK
Regulation mode:	activator
Biological process:	Raffinose utilization
Effector:
Regulog:	RafR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - ROK
By pathway - Raffinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -152 Score: 5.5 Sequence: TTTATTGCGTTAATCACAAAATA Locus tag: Blon_2458 Name: rafB Funciton: Raffinose ABC transporter, substrate-binding protein Locus tag: Blon_2457 Name: rafC Funciton: Raffinose ABC transporter, permease protein 1 Locus tag: Blon_2456 Name: rafD Funciton: Raffinose ABC transporter, permease protein 2
	Blon_2458	rafB	Raffinose ABC transporter, substrate-binding protein
	Blon_2457	rafC	Raffinose ABC transporter, permease protein 1
	Blon_2456	rafD	Raffinose ABC transporter, permease protein 2
Position: -43 Score: 5.5 Sequence: TATTTTGTGATTAACGCAATAAA Locus tag: Blon_2459 Name: rafR Funciton: Raffinose utilization transcriptional regulator, ROK family
	Blon_2459	rafR	Raffinose utilization transcriptional regulator, ROK family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD