Regulon of GntR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_1686
Regulator family:	LacI
Regulation mode:
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 7.4 Sequence: TAGGGGTATCGATACACCTA Locus tag: BDP_1687 Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: BDP_1688 Name: gntP Funciton: Gluconate permease
	BDP_1687	idnO	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	BDP_1688	gntP	Gluconate permease
Position: -177 Score: 7.4 Sequence: TAGGTGTATCGATACCCCTA Locus tag: BDP_1686 Name: gntR Funciton: Transcriptional regulator for gluconate utilization, LacI family
	BDP_1686	gntR	Transcriptional regulator for gluconate utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD