Profile of regulator GntR in Bifidobacteriaceae
Regulator family: | LacI |
Regulation mode: | |
Biological process: | Gluconate utilization |
Effector: | Gluconate |
Regulog: | GntR - Bifidobacteriaceae |

Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
Transcription factor binding sites
Locus Tag | Name | Position | Score | Sequence | |
---|---|---|---|---|---|
Bifidobacterium dentium Bd1 | |||||
BDP_1686 | gntR | -177 | 7.4 | TAGGTGTATCGATACCCCTA | |
BDP_1687 | idnO | -91 | 7.4 | TAGGGGTATCGATACACCTA |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |