Regulon of BDP_1267 in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_1267
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BDP_1267 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -210 Score: 5.8 Sequence: TAATTAGAACGTTCTAATTT Locus tag: BDP_1267 Name: BDP_1267 Funciton: Transcriptional regulator, LacI family
	BDP_1267	BDP_1267	Transcriptional regulator, LacI family
Position: -50 Score: 5.8 Sequence: AAATTAGAACGTTCTAATTA Locus tag: BDP_1268 Name: BDP_1268 Funciton: Putative carbohydrate ABC transporter, solute-binding protein Locus tag: BDP_1269 Name: BDP_1269 Funciton: Putative carbohydrate ABC transporter, permease protein 2 Locus tag: BDP_1270 Name: BDP_1270 Funciton: Putative carbohydrate ABC transporter, permease protein Locus tag: BDP_1271 Name: BDP_1271 Funciton: Putative amylo-alpha-1,6-glucosidase
	BDP_1268	BDP_1268	Putative carbohydrate ABC transporter, solute-binding protein
	BDP_1269	BDP_1269	Putative carbohydrate ABC transporter, permease protein 2
	BDP_1270	BDP_1270	Putative carbohydrate ABC transporter, permease protein
	BDP_1271	BDP_1271	Putative amylo-alpha-1,6-glucosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD